Review



nucleotides barcode tacggtagcagagacttggtct 3  (fluidigm)


Bioz Verified Symbol fluidigm is a verified supplier
Bioz Manufacturer Symbol fluidigm manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    fluidigm nucleotides barcode tacggtagcagagacttggtct 3
    Nucleotides Barcode Tacggtagcagagacttggtct 3, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 843 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/Access+Array/pmc11633968-116-33-46
    Average 93 stars, based on 843 article reviews
    nucleotides barcode tacggtagcagagacttggtct 3 - by Bioz Stars, 2026-11
    93/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Nucleic acid encoding reactions
    Article Snippet: .. For example, the first reaction mixtures can be prepared in separate compartments of a first microfluidic device to incorporate the barcode nucleotide sequences (e.g., Fluidigm Corporation's ACCESS ARRAYTM IFC (Integrated Fluidic Circuit) or MA006 IFC), and the second reaction mixtures can prepared in separate compartments of a second, different microfluidic device, e.g., to facilitate detection (e.g., one of Fluidigm Corporation's DYNAMIC ARRAYTM IFCs, using PCR or RT-PCR, with a double-stranded DNA binding dye, such as EvaGreen for detection). ..

    Article Title: Nucleic acid encoding reactions
    Article Snippet: .. For example, the first reaction mixtures can be prepared in separate compartments of a first microfluidic device to incorporate the barcode nucleotide sequences (e.g., Fluidigm Corporation's ACCESS ARRAYTM IFC (Integrated Fluidic Circuit) or MA006 IFC), and the second reaction mixtures can prepared in separate compartments of a second, different microfluidic device, e.g., to facilitate detection (e.g., one of Fluidigm Corporation's DYNAMIC ARRAYTM IFCs, using PCR or RT-PCR, with a double-stranded DNA binding dye, such as EvaGreen for detection). ..

    Article Title: Nucleic acid encoding reactions
    Article Snippet: .. For example, the first reaction mixtures can be prepared in separate compartments of a first microfluidic device to incorporate the barcode nucleotide sequences (e.g., Fluidigm Corporation's ACCESS ARRAYTM IFC (Integrated Fluidic Circuit) or MA006 IFC), and the second reaction mixtures can prepared in separate compartments of a second, different microfluidic device, e.g., to facilitate detection (e.g., one of Fluidigm Corporation's DYNAMIC ARRAYTM IFCs, using PCR or RT-PCR, with a double-stranded DNA binding dye, such as EvaGreen for detection). ..

    Binding Assay:

    Article Title: Nucleic acid encoding reactions
    Article Snippet: .. For example, the first reaction mixtures can be prepared in separate compartments of a first microfluidic device to incorporate the barcode nucleotide sequences (e.g., Fluidigm Corporation's ACCESS ARRAYTM IFC (Integrated Fluidic Circuit) or MA006 IFC), and the second reaction mixtures can prepared in separate compartments of a second, different microfluidic device, e.g., to facilitate detection (e.g., one of Fluidigm Corporation's DYNAMIC ARRAYTM IFCs, using PCR or RT-PCR, with a double-stranded DNA binding dye, such as EvaGreen for detection). ..

    Article Title: Nucleic acid encoding reactions
    Article Snippet: .. For example, the first reaction mixtures can be prepared in separate compartments of a first microfluidic device to incorporate the barcode nucleotide sequences (e.g., Fluidigm Corporation's ACCESS ARRAYTM IFC (Integrated Fluidic Circuit) or MA006 IFC), and the second reaction mixtures can prepared in separate compartments of a second, different microfluidic device, e.g., to facilitate detection (e.g., one of Fluidigm Corporation's DYNAMIC ARRAYTM IFCs, using PCR or RT-PCR, with a double-stranded DNA binding dye, such as EvaGreen for detection). ..

    Article Title: Nucleic acid encoding reactions
    Article Snippet: .. For example, the first reaction mixtures can be prepared in separate compartments of a first microfluidic device to incorporate the barcode nucleotide sequences (e.g., Fluidigm Corporation's ACCESS ARRAYTM IFC (Integrated Fluidic Circuit) or MA006 IFC), and the second reaction mixtures can prepared in separate compartments of a second, different microfluidic device, e.g., to facilitate detection (e.g., one of Fluidigm Corporation's DYNAMIC ARRAYTM IFCs, using PCR or RT-PCR, with a double-stranded DNA binding dye, such as EvaGreen for detection). ..



    Similar Products

    150-nucleotide paired-end illumina barcode sequencing  (Illumina Inc)
    90
    Illumina Inc 150-nucleotide paired-end illumina barcode sequencing
    150 Nucleotide Paired End Illumina Barcode Sequencing, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/150+nucleotide+paired+end+illumina+barcode+sequencing/bio_rxiv__2025__07__08__663783-60-7-9
    Average 90 stars, based on 1 article reviews
    150-nucleotide paired-end illumina barcode sequencing - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    8-nucleotide barcoded primers  (Illumina Inc)
    90
    Illumina Inc 8-nucleotide barcoded primers
    8 Nucleotide Barcoded Primers, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/8+nucleotide+barcoded+primers/pmc12048548__41467_2025_59280_MOESM5_ESM-13-11-27
    Average 90 stars, based on 1 article reviews
    8-nucleotide barcoded primers - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    10-nucleotide indexing set of barcodes  (Illumina Inc)
    90
    Illumina Inc 10-nucleotide indexing set of barcodes
    10 Nucleotide Indexing Set Of Barcodes, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/10+nucleotide+indexing+set+of+barcodes/pm40142380-87-6-8
    Average 90 stars, based on 1 article reviews
    10-nucleotide indexing set of barcodes - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    nucleotide blast analysis of the mitochondrial dna barcoding marker gene cytochrome c oxidase i (coi)  (StarSEQ GmbH)
    90
    StarSEQ GmbH nucleotide blast analysis of the mitochondrial dna barcoding marker gene cytochrome c oxidase i (coi)
    Nucleotide Blast Analysis Of The Mitochondrial Dna Barcoding Marker Gene Cytochrome C Oxidase I (Coi), supplied by StarSEQ GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/nucleotide+blast++analysis+of+the+mitochondrial+dna+barcoding+marker+gene+cytochrome+c+oxidase+i++coi+/pmc11704197-161-13-40
    Average 90 stars, based on 1 article reviews
    nucleotide blast analysis of the mitochondrial dna barcoding marker gene cytochrome c oxidase i (coi) - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    nucleotides barcode tacggtagcagagacttggtct 3  (fluidigm)
    93
    fluidigm nucleotides barcode tacggtagcagagacttggtct 3
    Nucleotides Barcode Tacggtagcagagacttggtct 3, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/Access+Array/pmc11633968-116-33-46
    Average 93 stars, based on 1 article reviews
    nucleotides barcode tacggtagcagagacttggtct 3 - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    dna barcodes available in the national center for biotechnology information nucleotide database  (Biotechnology Information)
    90
    Biotechnology Information dna barcodes available in the national center for biotechnology information nucleotide database
    Dna Barcodes Available In The National Center For Biotechnology Information Nucleotide Database, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/dna+barcodes/pm39596209-24-12-20
    Average 90 stars, based on 1 article reviews
    dna barcodes available in the national center for biotechnology information nucleotide database - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier
    nucleotides barcode tac ggt agc aga gac ttg gtct 3ʹ  (fluidigm)
    93
    fluidigm nucleotides barcode tac ggt agc aga gac ttg gtct 3ʹ
    Nucleotides Barcode Tac Ggt Agc Aga Gac Ttg Gtct 3ʹ, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/Access+Array/pm39198637-97-12-29
    Average 93 stars, based on 1 article reviews
    nucleotides barcode tac ggt agc aga gac ttg gtct 3ʹ - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    barcode nucleotide sequences  (fluidigm)
    93
    fluidigm barcode nucleotide sequences
    Barcode Nucleotide Sequences, supplied by fluidigm, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/Access+Array/us12018323-527-20-24
    Average 93 stars, based on 1 article reviews
    barcode nucleotide sequences - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    sequencing adaptors with unique barcode nucleotides  (Illumina Inc)
    90
    Illumina Inc sequencing adaptors with unique barcode nucleotides
    Sequencing Adaptors With Unique Barcode Nucleotides, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/nucleotide+barcode/sequencing+adaptors+with+unique+barcode+nucleotides/pmc11199121-76-5-0
    Average 90 stars, based on 1 article reviews
    sequencing adaptors with unique barcode nucleotides - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results